Class: BioMap
Retrieve information for single element of BioMap
object
Info
= getInfo(BioObj
, Element
)
returns Info
= getInfo(BioObj
, Element
)Info
,
a tab-delimited character vector containing information about a single
element in BioObj
, a BioMap
object.
|
Object of the |
|
One of the following to specify one element in
|
|
Tab-delimited character vector containing information about
a single element in
|
Construct a BioMap
object, and then retrieve
information for the second element in the object:
% Construct a BioMap object from a SAM file BMObj1 = BioMap('ex1.sam'); % Retrieve information for the second element in the object element2Info = getInfo(BMObj1, 2)
element2Info = EAS54_65:7:152:368:113 73 3 99 35M CTAGTGGCTCATTGTAAATGTGTGGTTTAACTCGT <<<<<<<<<<0<<<<655<<7<<<:9<<3/:<6):